5. Each molecule of Deoxyribonucleic Acid (DNA) is a double helix formed from two complementary strands of nucleotides held tInputs from keyboard: Enter one of strand in a molecule of DNA: ATATCTTGCGCTCTTGATTCGCATATTCT Output: Complementary strand: T

Please finish this question in C language programming

Thank you so much!

5. Each molecule of Deoxyribonucleic Acid (DNA) is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. Write a program to display this complementary strand if given any one of stand with base A, T, G, C Inputs from keyboard: Enter one of strand in a molecule of DNA: ATATGGATGGTGTTTGGCTCTG Output: Complementary strand: TATACCTACCACAAACCGAGAC Inputs from keyboard: TCTCCGGTTGATT Output: Complementary strand: AGAGGCCAACTAA Inputs from keyboard: Enter one of strand in a molecule of DNA: ATATCTTGCGCTCTTGATTCGCATATTCT Output: Complementary strand: TATAGAACGCGAGAACTAAGCGTATAAGA Inputs from keyboard: Enter one of strand in a molecule of DNA: GCGTTTCGTTGCAA Output: Complementary strand: CGCAAAGCAACGTT Inputs from keyboard: Enter one of strand in a molecule of DNA: TTAACGCACAACCTAGACTT Output: Complementary strand: AATTGCGTGTTGGATCTGAA Notice that A & T and G & C are always pair



Source link

Leave a Reply

Your email address will not be published. Required fields are marked *